At present, the molecular mechanisms underlying the cytolethal effects induced by K. oxytoca in this study remain unknown. Supplementary Material [Supplemental material] Click here to view. Acknowledgments We thank Susanne H?usler for her assistance in performing the PFGE and Christina Strempfl and Bernadette Neuhold for their technical HTC assistance. This work was financed by the University of Graz, the Medical University of Graz (Hygiene Fonds), and Austrian Science Fund FWF project P18607 (to E.L.Z.). Footnotes Published ahead of print on 6 January 2010. ?Supplemental material for this article may be found at http://jcm.asm.org/.
Gastrointestinal stromal tumor (GIST) is the most common mesenchymal tumor of the gastrointestinal tract.

In 1998, Hirota et al1 made the seminal discovery that these tumors express the KIT tyrosine kinase and commonly harbor oncogenic mutations in the KIT gene. Subsequently, several investigators reported in vitro evidence of antitumor activity of the small molecule KIT inhibitor imatinib mesylate (Glivec/Gleevec; Novartis Pharma AG, Basel, Switzerland) against KIT mutant cell lines.2,3 These observations led to clinical testing of this agent as a medical therapy for patients who have advanced disease.4-7 When the early trials were underway, laboratory studies revealed significant molecular heterogeneity among GISTs. Notably, 75% to 85% of GISTs had an activating mutation of KIT, 5% to 7% had an activating mutation of the homologous PDGFRA kinase, and approximately 12% to 15% of GISTs did not have a detectable mutation of either kinase.

8-11 Correlative molecular studies in phase I to II studies revealed significant differences in objective response, progression-free survival (ie, time to tumor progression [TTP]), and overall survival (OS) between GISTs with different kinase genotypes. Specifically, the outcomes for patients with KIT exon 11�Cmutant GIST were better than for patients with KIT exon 9�Cmutant GIST or tumors without a detectable KIT mutation.7,8,12 Prospective studies of the relationship between kinase genotype and imatinib response were incorporated into two pivotal phase III trials that were designed to compare 400 mg and 800 mg daily doses of imatinib.13-15 In this study, we examine the correlation between kinase genotype, imatinib dose, and clinical outcomes in 397 patients with GIST from the North American phase III trial.14 Our findings confirmed that KIT exon 11 mutation is a positive predictive factor for objective response, TTP, and OS. This study also provides prognostic data for other GIST genotypes, including those with KIT exon 9 mutation, PDGFRA mutation, and wild-type Cilengitide (WT) status.

Mice were treated in accordance kinase inhibitor Ivacaftor with the Declaration of Helsinki and with the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources, 1996) as adopted and promulgated by the National Institutes of Health. Treatment protocols were approved by the University of Louisville Institutional Animal Care and Use Committee. Polymerase Chain Reaction Protocol for GSTP1/P2 Screening. Polymerase chain reaction products were used to genotype WT and GSTP-null mice using primers that amplified a region between exons 5 and 6 of GSTP1 and a region in the lacZ gene to identify a null allele. Primers (5��C3��) were WT (P1, ggccacccaactactgtgat; P2, agaaggccaggtcctaaagc) and null (P3, ctgtagcggctgatgttgaa; P4, atggcgattaccgttgatgt) (Henderson et al., 1998).

All four primers were mixed with tail DNA, amplified using Taq polymerase (Promega, Madison, WI), and the products obtained were separated on 2% agarose gel with WT band at 200 base pair and null band at 300 base pair. GST Expression and Enzymatic Activity. Western blots for tissue expression of specific GST isoforms (A, M, and P) were developed using commercially available standards and antibodies. Total glutathione-conjugating activity of GSTs with 1-chloro,2,4-dinitrobenzene (CDNB; 1 mM) and ethacrynic acid (EA; 200 ��M) was measured in fractions of kidney, liver, lung, small intestine, stomach, and urinary bladder homogenates (Habig et al., 1974). CY Exposure. In a preliminary experiment, the dose dependence of CY-induced hemorrhagic cystitis (100�C300 mg/kg, i.p., 24 h) was measured in male C57BL/6 mice.

The threshold for CY-induced dyslipidemia and cardiotoxicity was greater than 200 mg/kg, whereas increased bladder wet weight occurred with CY at the 200-mg/kg dose. Therefore, age- and strain-matched male WT and GSTP-null mice were exposed to sterile saline (control, 0.1 ml, i.p.) or to CY in saline (50 or 200 mg/kg, i.p.) and sacrificed at 4 or 24 h post-treatment to measure CY-induced effects. To assess the role of thiols in CY-induced toxicity, the mice were pretreated with mesna (2-mercaptoethanesulfonic acid; 80 mg/kg, i.p.; 1 h pre-CY) (Batista et al., 2007) and euthanized 4 h after treatment with CY. For measurements of CY metabolism, isolated hepatic microsome fractions were incubated with CY, and acrolein (2-propenal) formation was monitored as a fluorescent product using meta-3-aminophenol (Alarcon, 1968).

An acrolein standard curve (0�C50 ��M; Sigma-Aldrich, St. Louis, MO) was prepared in 0.05 mM potassium phosphate buffer, 0.1 mM EDTA, pH 7.4, and mixed with a solution of 3-aminophenol (6 mg/ml) and hydroxylamine hydrochloride (6 mg/ml) in 1 M HCl. The mixture was heated at 90��C for 20 min and then cooled to room temperature. The fluorescence intensity of the product was measured at 350 Dacomitinib nm excitation and 515 nm emission.

Results NEFH Promoter Is Methylated and Its Expression Is Down-Regulated in ESCC After identifying NEFH as a candidate methylated gene in ESCC [14], we treated gDNA with bisulfite and re-sequenced the NEFH promoter in 12 ESCC cell lines and 20 pairs of primary ESCC (PT) Axitinib CAS with their corresponding normal esophageal tissues (PN). All 12 ESCC cell lines tested and 65% (13/20) of PT harbored NEFH promoter methylation, whereas no methylation was found in paired normal samples (PN) (0%) and two non-tumorigenic cell lines, HEK293 (Fig. S1). Methylation of the NEFH promoter was further confirmed by conventional methylation-specific PCR (MSP) in three randomly selected pairs of normal and tumor tissue samples.

PCR-amplification with methylation-specific primers was clearly seen only in PT whereas amplification of non-methylated-DNA was seen only in PN, consistent with the results of bisulfite-sequencing (Fig. 1a, left). MSP analysis in primary ESCC tissues from five more patients demonstrated NEFH promoter methylation in 3 cases while the remaining two did not harbor methylation (Fig. 1a, right). Figure 1 Analysis of NEFH methylation and expression in ESCC. To quantify promoter methylation, real-time TaqMan-MSP analysis was performed with a probe targeted to the CpG island of NEFH. Forty-nine cases of primary ESCC and 15 normal esophageal epithelial tissues from non-cancer patients (NN) were included to compare methylation levels between cancer and non-cancer patients. The distribution of methylation values in each group of samples is shown in Figure 1b.

The overall TaqMan methylation value (TaqMeth V) detected in primary ESCC (42.84��68.13, mean �� SD) was significantly higher than that in normal tissues (0.08��1.63, mean �� SD) (P<0.001) (Fig. 1c). Testing methylation of NEFH resulted in a highly discriminative receiver�Coperator characteristic (ROC) curve profile, clearly distinguishing ESCC from PN (Fig. 1d). The optimal cut-off (value, 0.985) was calculated from the ROC analysis in order to maximize sensitivity and specificity. No NN nor PN samples exhibited a value over 0.985, yielding 100% specificity, while 85.5% (59/69) of primary ESCC tissues displayed NEFH promoter methylation (P<0.001, ESCC vs. PN, Fisher's exact test). No correlation between clinical features and NEFH methylation was found. If functionally relevant, promoter methylation should correlate with decreased expression or silencing of the gene. To examine the transcriptional levels of NEFH, RT-PCR was performed using primers specific for NEFH cDNA. Carfilzomib NEFH expression was hardly detectable in most of the ESCC cell lines except for KYSE30 (Fig. 1e, left).

As reported in [32] www.selleckchem.com/products/CHIR-258.html and shown in Table 1, the hGrx1-roGFP2 biosensor is not sensitive to direct interaction with micromolar H2O2 concentrations. However, millimolar H2O2 might lead to a direct oxidation of the probe. Since, however, H2O2 is likely to be at least partially detoxified by the antioxidative defense systems of the parasite-host cell unit, an oxidizing effect on the glutathione system also needs to be considered. The long and steady increase in the ratio after treatment with THBP might be associated to the fact that TBHP is, in contrast to H2O2, not detoxified by red blood cell catalase and is therefore likely to have more pronounced and longer-lasting effects. Induction of nitrosative stress using the peroxynitrite generator SIN-1 also led to a rapid ratio change.

Therefore, we assume that ROS and RNS do affect EGSH in P. falciparum and that hGrx1-roGFP2 seems to be a suitable tool to monitor these changes in living cells. However, when using the redox probe, one has to take into account that some compounds, independent from glutathione, might also directly interact with the probe. Thus, before testing the effects of antimalarial compounds on the ratio of the probe in living parasites, we characterized their direct in vitro interaction with recombinant hGrx1-roGFP2. Table 1 and Figs. 3 and S5 summarize the data for different concentrations and incubation times. Whereas high concentrations of oxidizing agents and redox cyclers such as GSSG, diamide, H2O2, MB, and PYO led to direct interactions with the probe, antimalarial drugs including the quinolines and artemisinin derivatives did not cause a major increase in the fluorescence ratio even at concentrations up to 100 ��M and after 24 h incubation.

These data can of course only be indirectly compared to the situation in vivo, where a direct interaction is hindered by multiple cell membranes, degradation of the stressors, and binding to other proteins. However, the data are important when interpreting the results described in the next paragraph. Whereas compounds such as MB might induce changes in the probe via direct interaction and by acting on the cellular redox metabolism, the direct interactions of the other drugs with the probe seem to be negligible. Furthermore, effects induced by diamide or H2O2 might recover more rapidly than those induced by potent redox cyclers such as MB and pyocyanin.

Effects of antimalarial drugs on the cytosolic glutathione redox potential In order to investigate whether hGrx1-roGFP2 can be used to monitor changes in EGSH after the treatment of cell cultures with antimalarial drugs, we incubated the Plasmodium falciparum strains 3D7 and Dd2 with different concentrations of MB, quinoline, and artemisinin derivatives Anacetrapib in short-term (5 min), medium-term (4 h), and long-term (24 h) experiments (Table 2, Figs. 4�C7).

Figure 5 B-cell overnight delivery leukemia/lymphoma 2 mRNA expression in tumor samples as detected by real time-polymerase chain reaction (n = 10 mice per group). bP < 0.01 vs control and imatinib groups. Each bar represents the mean �� SD. M: Marker, 100-2000 bp; ... DISCUSSION GISTs are the most common mesenchymal neoplasms of the gastrointestinal tract, and the worldwide incidence of GISTs has been estimated to be 14-20 per million people. GISTs are low-grade malignant tumors that are believed to originate from neoplastic transformation of the interstitial cells of Cajal[12-14]. The overall 5-year survival rate for GIST patients is about 45% in the United States[15]. Nearly 50% of GISTs treated with imatinib ultimately demonstrate resistance in the first 2 years post-treatment, and thus a new treatment strategy and/or more effective drug is needed.

There are at least two different mechanisms for the immortalization of tumor cells: reactivation of telomerase, and the inactivation of tumor suppressor genes such as p53 and pRB that control cellular senescence[16]. Human telomerase, which contains an RNA component, telomerase-associated protein and a catalytic subunit[17-20], is activated in 80%-90% of carcinomas derived from various organs such as stomach, colon, lung and breast[21-23]. The rate of telomere DNA shortening is regulated by telomerase expression and activity[24-26]. In our study, we evaluated telomerase activity in GISTs and found that telomerase activity was markedly elevated, consistent with findings for other tumor types.

Controlling the levels of the anti-apoptotic bcl-2 family proteins is critical for regulating cell growth and apoptosis. bcl-2 localizes to cellular membranes, particularly in mitochondria, and can inhibit mitochondrial release of substances involved in signaling either the onset or execution of apoptosis[27], and higher levels of bcl-2 promote the development and progression of many tumors[28]. bcl-2 promotes cell survival by inhibiting adapters needed for activation of the proteases (caspases) that dismantle the cell. Therefore, bcl-2 and related cytoplasmic proteins are key inhibitory factors of apoptosis, which indeed is critical for development, tissue homeostasis, and protection against pathogens[29-31]. Here, we found that the level of bcl-2 mRNA was significantly upregulated in GISTs, consistent with its established role in promoting tumorigenesis.

The drug resistance of a malignant tumor is an important issue for conventional clinical therapies such as chemotherapy, radiotherapy, and immunotherapy. If telomerase activity and/or expression is inhibited in cancer cells, the cells may become relatively more vulnerable to these conventional therapies[32]. In this study, transfection Brefeldin_A with PS-ASODN significantly inhibited telomerase activity and induced apoptosis compared with the imatinib and control groups.

NS398 was reported to cause significant growth inhibition in HCA-7 colon carcinoma cells (Zhang and DuBois, 2001). www.selleckchem.com/products/Gefitinib.html It inhibits PGE2 synthesis and arrests cell cycle in G1 phase by enhancing p27KIP1 expression (Hung et al, 2000). NS398-dependent apoptosis in colon cancer cells occurs through a cytochrome c-dependent pathway (Li et al, 2001). Reducing VEGF levels with NS398 treatment refers to its anti-angiogenic effect (Abdelrahim and Safe, 2005; Huang et al, 2005). Inhibitory effects of NS398 on cancer invasiveness and metastatic growth have been proven both in vitro in cell culture (Abiru et al, 2002; Yao et al, 2004; Chen et al, 2006; Banu et al, 2007; Leung et al, 2008) and in vivo in animal model experiments (Chen et al, 2006; Leung et al, 2008).

Therapeutic effects of NS398 can be exerted by downregulation of matrix metalloproteinase-2 expression (Yao et al, 2004; Leung et al, 2008), blocking of epidermal growth factor receptor transactivation (Banu et al, 2007) or inhibition of HGF-induced invasiveness (Abiru et al, 2002; Chen et al, 2006). However, the complete molecular background of NS398 treatment on colon adenocarcinoma cells has not been analysed yet. The aims of this study were to analyse the gene expression modulating effect of NS398 selective COX2 inhibitor on the HT29 colon adenocarcinoma cell line and to correlate this effect to the modulation in gene expression observed during normal-adenoma and normal-CRC transition when biopsy samples were analysed. Materials and methods Cell culture HT29 colon adenocarcinoma cells were cultured at 37��C with 5% CO2 in RPMI-1640 medium (Sigma-Aldrich, St Louis, MO, USA) containing gentamycin and 10% FCS.

In six-well plates, 300000cells per well were cultured for 1 day, and were then treated with 10, 25 and 100��M NS398 (Sigma-Aldrich, diluted in DMSO) for 72h in FCS-free medium. 0.1% DMSO was used as control. Total RNA was extracted from three samples treated with 100��M NS398 and from three untreated controls for microarray analysis. In parallel, 40000cells Entinostat per slide were cytocentrifuged and fixed for immunocytochemical analysis. MTT cell proliferation assay In 96-well plates, 5000 HT29 cells per well were maintained for 24h in 100��l RPMI-1640 medium containing 10% FCS, after which, the cells were treated with 10, 25 and 100��M NS398 (Sigma-Aldrich, diluted in DMSO) for 48 or 72h in FCS-free medium. A volume of 0.5mgml?1 of MTT (methylthiazolyldiphenyl-tetrazolium bromide, Sigma-Aldrich) was then added to each well, and the cells were incubated for 4h at 37��C.

LBY135 was supplied from Novartis (Basel, selleck chem Switzerland), Sorafenib (BAY 43-9006) from Bayer (Leverkusen, Germany). Viability test Cell viability was determined by a colorimetric 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. HCC cell lines were seeded onto 96-well plates. On day one after seeding, cells were treated as indicated. We added 10 ��L MTT (5 mg/mL) 48 h after treatment and incubated cells for a further 3 h at 37��C. Next, supernatant was discarded and cells were lysed by adding 100 ��L 1-propanol to each well followed by shaking plates till complete lysis. Absorbance was measured at 550 nm in a microtiter plate reader. A viability of 1 was defined as the absorbance of untreated cells.

Coating of microtiter plates To ease ligand-receptor interaction with the crosslinking supplement IgG F(ab)��2, 96-well plates were coated with IgG F(ab)��2 before seeding cells. One hundred microliters of sterile filtered 100 nmol/L sodium bicarbonate buffer (pH 9.2) containing 5 ��g/mL IgG F(ab)��2 was added to each well and incubated for 2 h at room temperature (RT). After replacement of F(ab)��2 buffer by cell culture media, plates were stored at 4��C. Coated plates were stable for at least 1 wk. RNAi and transfection To knock-down protein expression, we administered specific small interfering RNA (siRNA) against MCL-1 or BCL-xL. As a control we used siRNA specific for green fluorescent protein (GFP).

The following siRNA sequences were applied (MWG Biotech, Ebersberg, Germany): BCL-xL, 5′-gcuuggauaaagaugcaaTT-3′ (sense) and 5′-uugcaucuuuaucccaagcAG-3′ (antisense), MCL-1, 5′-aaguaucacagacguucucTT-3′ (sense) and 5′-gagaacgucugugauacuuTT-3′ (antisense), GFP, 5′-ggcuacguccaggagcgcaccTT-3′ (sense) and 5′-ggugcgcuccuggacguagccTT-3′ (antisense). Here, capitals represent deoxyribonucleotides and lower case letters represent ribonucleotides. Huh7 cells were seeded onto 12-well plates and after 24 h transiently transfected in OPTIMEM with Lipofectamine RNAiMax (Invitrogen) according to the manufacturer��s protocol. Expression levels were analyzed 24, 48 and 72 h after transfection via Western blotting analysis. Detection of apoptosis HCC cells were seeded onto 12-well plates and treated as indicated 1 d after transfection. Forty eight hours after treatment, cells were washed with cold PBS, collected and resuspended in a hypotonic buffer containing 0.1% (w/v) sodium citrate, 0.1% (v/v) Triton X-100, and 50 ��g/mL Propidium Dacomitinib iodide (PI, Sigma). After 3 h incubation at 4��C, nuclei from apoptotic cells were quantified by fluorometric absorbance cell sorting according to the protocol of Nicoletti et al[24]. Cell lysis and Western blotting Cell lysis, SDS-PAGE and Western blotting were performed as described previously[13].

24, p = .08) at trend-level significance. Correlations with all other measures Rapamycin mTOR were nonsignificant. Conclusions Summary of Findings This study demonstrated robust effects of abstinence on withdrawal symptoms, smoking urge, and negative affect in a sample of adolescent smokers. However, abstinence did not significantly influence positive affect, or reactive irritability. Although abstinence did not increase urge reactivity to smoking cues, it did increase PPC and affect, that is, urge and affect ratings in the presence of smoking cues, unadjusted for responses to neutral cues. These findings extend prior research by testing a broad array of outcome measures within one study, including indices of reactive irritability and cue reactivity that have not been examined in prior controlled studies of adolescent tobacco abstinence.

This multimeasure approach is useful in characterizing the phenomenology of adolescent smoking abstinence by showing that responses of adolescent smokers to abstinence overlap those of adult smokers in some (i.e., increases in negative affect, withdrawal symptoms, and overall smoking urges; Colby et al., 2010; Corrigall et al., 2001; Zack et al., 2001) but not other aspects (i.e., no increase in reactive irritability or reduction in positive affect; al��Absi et al., 2005, 2004; Leventhal et al., 2010). Contrary to our hypotheses, we did not find that acute abstinence led to increases in urge or affective reactivity to smoking cues.

Inspection of mean values of QSU scores after neutral cue exposure indicated that ABST participants scored close to the upper limit of the range of possible values on this measure in S2, leaving limited range to demonstrate increases in urge following the smoking cue exposure, resulting in a ceiling effect for cue-induced change scores. This likely accounted for ABST participants showing a reduction in urge reactivity from S1 to S2. Similar findings have frequently been reported in adult smokers (Drobes & Tiffany, 1997; Sayette & Hufford, 1994; Sayette et al., 2001; Tidey, Rohsenow, Kaplan, Swift, & Adolfo, 2008), leading researchers to additionally examine effects on PPC, focusing on urge ratings during exposure to smoking cues without adjusting for urges during neutral cues (e.g., Donny, Griffin, Shiffman, & Sayette, 2008; Sayette et al., 2000). Studies support the clinical relevance of PPC and show that peak provoked urge ratings are reduced by nicotine patch (Morissette, Palfai, Gulliver, Spiegel, & Barlow, 2005; Tiffany, Cox, & Elash, 2000; Waters et al., 2004) and nicotine Entinostat gum (Niaura et al., 2005; Shiffman et al.

In extreme cases, one host sex may be so rare (e.g., males in cyclically parthenogenetic species, such as aphids, are absent for large parts of the year) that the parasite rarely encounters them (Figure 2B). In this case, parasites sampled from the rare host would actually be adapted to the other sex (the common sex), and parasites from both origins would www.selleckchem.com/products/Abiraterone.html be fitter in the common host sex (Figure 1B). Alternatively, the parasite could adapt to a host trait that is found in only one host sex, such as primary or secondary sexual traits. The parasite populations may adapt only to this sex, even if the likelihood of encountering the other sex is high (Figure 2C). In this case, parasites sampled in the host sex to which they are not adapted (if this is possible), would perform better in the opposite host sex (Figure 1B).

Plastic Sex-Specific Disease Expression Phenotypic plasticity, a property whereby the same genotype translates into distinct phenotypes depending on the environment, is a common way for organisms to deal with fluctuating environments [15]. Parasites facing distinct male and female host environments might have evolved plasticity in relation to those environments and be able to express host sex�Cspecific traits accordingly. Following Scheiner [16], the plastic expression of a trait is favored when 1) variability among environments is high, 2) environments are equally abundant, 3) the strength of selection is equal in both environments, 4) the environmental cue determining the phenotype is highly correlated with the environment of selection, and 5) the cost of plasticity, which is the cost of maintaining the genetic and cellular machinery necessary to be plastic, is compensated by its advantage.

If these conditions are met, phenotypic plasticity is expected to evolve (Figure 2D); otherwise, a single generalist phenotype will be favored. If there is plasticity, then parasites originating from different host sexes will be equally fit when tested in the same sex environment (Figure 1A). Host Population Structure and Parasite Transmission The evolution of sex-specific parasite adaptation is affected by the likelihood of parasites being transmitted within or between host sexes (Figure 2). This depends strongly on the host species and the ecological circumstances (Table 2). Here, we focus mainly on cases where the likelihood of encountering a host of the opposite sex is low.

For example, males and females are not always equally abundant and, therefore, parasite transmission will occur among the most common sex. Biased sex ratios are often observed in natural populations [17]�C[20], and are even an intrinsic characteristic of certain species, for example, the abundance of females in cyclically parthenogenetic species (e.g., aphids, cladocera, rotifers), in sequential hermaphrodite species [21], and in many haplodiploid GSK-3 species such as ants, bees, wasps, and mites.

For normalization purposes expression levels of L19 were determined accordingly in the same run to exclude effects of inter-run variability (5��-ACCCCAATGAGACCAATGAAAT-3��, selleck chemicals llc 5��-CAGCCCATCTTTGATGAGCTT-3��). The relative expression of p21 normalized to L19 levels was calculated for each sample and plotted on a graph. Total Lysis, Nuclear/Cytosolic Separation, and Western Blotting Cells were lysed using total lysis buffer RIPA (1% NP40, 0.1% SDS, 1% DCA, 50 mM Tris HCl pH 7.2) with added protease and phosphatase inhibitors as previously described [20], [21]. Cytoplasmic and nuclear fractions were extracted with NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, Rockford, IL) according to the manufacturer��s instruction.

Western blotting was performed using standard protocols with 4�C20% polyacrylamide gels, nitrocellulose membrane transfers, overnight incubation with primary antibody at 4��C followed by horseradish peroxidase-linked secondary antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) and detection by ECL (Amersham, Little Chalfont, UK) [20], [21], visualization, and quantification of chemiluminescence with the LAS-3000 (FujifilmUSA, Valhalla, NY). siRNA and Transfection Two specific siRNAs for each p21 and SMAD4 (Ambion, Austin, TX and Santa Cruz Biotechnology) were transiently delivered at a final concentration of 10 nM via electroporation using the AMAXA Nucleofector (Lonza, Basel, Switzerland) in 12-well plates at a density of 2��106 according to the manufacturer��s instructions. Transfection efficiency was confirmed using the pmaxGFP? Control Vector (Lonza).

Forty-eight hours post transfection, colon cancer cells were lysed for subsequent RNA and protein extraction. Migration/Invasion Assay Migration assays were performed as previously described [20]. Briefly, Corning Costar Transwell 12 well plates (8 ��m pores, Corning, NY) with fibronectin or matrigel (Sigma, St. Louis, MO) were seeded with colon cancer cells with or without ligand in the presence or absence of siRNA. Cells were then allowed to migrate for 4 hours, stained, and images were captured using an Axiovert 2000 microscope with an AxioCAM HRC Camera (both Zeiss Microimaging, Thornwood, NY). Images from 5 microscopic fields at the center of each well were counted.

Immunohistochemistry for ACVR2, TGFBR2, p21 Expression and Localization Slides containing primary colon cancer tissues were processed as previously described [6] and stained for ACVR2, TGFBR2, and p21 using the Catalyzed Signal Amplification Brefeldin_A System (CSA) by DAKO (Carpinteria, CA). ACVR2 and TGFBR2 staining was grouped into negative (no or weak signal) and positive (moderate or strong signal) receptor status. The percentage of p21 positive nuclei in each cancer samples was assessed. Tumors with more than 50% of p21 positive nuclei were scored as nuclear positive cancers.