Mice were treated in accordance kinase inhibitor Ivacaftor with the Declaration of Helsinki and with the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources, 1996) as adopted and promulgated by the National Institutes of Health. Treatment protocols were approved by the University of Louisville Institutional Animal Care and Use Committee. Polymerase Chain Reaction Protocol for GSTP1/P2 Screening. Polymerase chain reaction products were used to genotype WT and GSTP-null mice using primers that amplified a region between exons 5 and 6 of GSTP1 and a region in the lacZ gene to identify a null allele. Primers (5��C3��) were WT (P1, ggccacccaactactgtgat; P2, agaaggccaggtcctaaagc) and null (P3, ctgtagcggctgatgttgaa; P4, atggcgattaccgttgatgt) (Henderson et al., 1998).

All four primers were mixed with tail DNA, amplified using Taq polymerase (Promega, Madison, WI), and the products obtained were separated on 2% agarose gel with WT band at 200 base pair and null band at 300 base pair. GST Expression and Enzymatic Activity. Western blots for tissue expression of specific GST isoforms (A, M, and P) were developed using commercially available standards and antibodies. Total glutathione-conjugating activity of GSTs with 1-chloro,2,4-dinitrobenzene (CDNB; 1 mM) and ethacrynic acid (EA; 200 ��M) was measured in fractions of kidney, liver, lung, small intestine, stomach, and urinary bladder homogenates (Habig et al., 1974). CY Exposure. In a preliminary experiment, the dose dependence of CY-induced hemorrhagic cystitis (100�C300 mg/kg, i.p., 24 h) was measured in male C57BL/6 mice.

The threshold for CY-induced dyslipidemia and cardiotoxicity was greater than 200 mg/kg, whereas increased bladder wet weight occurred with CY at the 200-mg/kg dose. Therefore, age- and strain-matched male WT and GSTP-null mice were exposed to sterile saline (control, 0.1 ml, i.p.) or to CY in saline (50 or 200 mg/kg, i.p.) and sacrificed at 4 or 24 h post-treatment to measure CY-induced effects. To assess the role of thiols in CY-induced toxicity, the mice were pretreated with mesna (2-mercaptoethanesulfonic acid; 80 mg/kg, i.p.; 1 h pre-CY) (Batista et al., 2007) and euthanized 4 h after treatment with CY. For measurements of CY metabolism, isolated hepatic microsome fractions were incubated with CY, and acrolein (2-propenal) formation was monitored as a fluorescent product using meta-3-aminophenol (Alarcon, 1968).

An acrolein standard curve (0�C50 ��M; Sigma-Aldrich, St. Louis, MO) was prepared in 0.05 mM potassium phosphate buffer, 0.1 mM EDTA, pH 7.4, and mixed with a solution of 3-aminophenol (6 mg/ml) and hydroxylamine hydrochloride (6 mg/ml) in 1 M HCl. The mixture was heated at 90��C for 20 min and then cooled to room temperature. The fluorescence intensity of the product was measured at 350 Dacomitinib nm excitation and 515 nm emission.