Results: Expression of CD24 and CD44 in gastric cancers significantly higher compare to those in the paired control groups. (45.5%vs 0.0%, and 61.0%vs 0.0%, P < 0.001). The overall survival rate was significantly higher in CD44 (−) group than CD44 (+) group in 290 patients (P < 0.05). ABT-263 cost The overall survival rate of patients who were CD24(+)/CD44(+) expression was significantly lower. Multivariate regression analysis indicated that CD24(+)/CD44(+)

expression and TNM stage, but not lymph-vascular invasions, were independent prognostic factors in gastric cancers (P < 0.05). However, no statistically significant difference was found in the expression levels of CD24 /CD44 between H.pylori (+) and H.pylori (−) gastric cancer (P > 0.05). Conclusion: Individual expression of CD44, and combined expression of CD24/CD44 was associated with survival rates of gastric carcinoma. CD24/CD44 might play important role in the gastric carcinogenesis. This work was part supported by National Natural Science Foundation

of China, No. 81273065 and No.81072369. Key Word(s): 1. cancer stem cell; 2. CD24; 3. CD44; 4. gastric cancer; Presenting Author: SIMENG WANG Additional Authors: RUI WANG, FENGRONG HU, ZENGSHAN LI, LIUCUN GAO, SHANHONG TANG, XIN WANG, SIJUN HU, YONGZHAN NIE, JUN TIE, DAIMING FAN Corresponding Author: JUN TIE, DAIMING FAN Affiliations: Xijing Hospital of Digestive Diseases Objective: During the ensuing decade transcription factor SOX2 is solidified VEGFR inhibitor as one of the hallmark participants throughout the developmental process in stomach. Ectopic SOX2 levels are responsible for exerting confounding MCE公司 impacts that enable normal cells to become tumorigenic and ultimately

malignant on multistep evolution of human gastric carcinoma (GC). We thus identify SOX2 expression profiling over the course of a GC lifespan, encompassing the contributions of SOX2 to our understanding of GC tumorigenesis and prognosis. In addition, the essence of transcription factor regulation exhibited by SOX2 has served both to clarify and modulate the original formulation of cancer phenotypes in GC. Here a central role for SOX2 that governs GC establishment and progression reflected on challenges arising in analogous studies and highlighted mechanistic concepts that might be integral to a more rational elaboration of SOX2-associated traits in GC. Methods: To determine SOX2 that might participate in GC progression rather than passive bystanders, the heterogeneity of SOX2 levels was detected by western blot and immunohistochemistry in human gastric specimens stratified by pathological status. Given the correlations between SOX2 expression and clinical progression, we assessed the prognostic roles for SOX2 elaborately for further characterization. To better enumerate SOX2-relevant features, we stably expressed SOX2 in MKN28 human gastric cancer cells.

Conclusions:  AlbuMAX II® (Gibco BRL) can this website be used as

a serum/blood replacement for the cultivation of H. pylori in solid and liquid media. This medium could be useful for an improved understanding of H. pylori metabolism or for antigen production. Furthermore, AlbuMAX II® (Gibco BRL) may be suitable for use in remote locations, particularly in areas where frozen storage of serum may be a problem. “
“Background: Helicobacter pylori infection is a most frequent cause of chronic gastritis. H. pylori may decrease absorption of oral thyroxine by decreasing gastric acid secretion in the stomach. In this study, we aimed to investigate the change in thyroid function tests of the cases after H. pylori eradication who were not responding

to high doses of thyroxine treatment before H. pylori eradication. Methods:  Hypothyroid cases who were not responding to high doses of thyroxine among the ones presented to Endocrinology and Gastroenterohepatology Clinics of Sisli Etfal Training and Research Hospital between 2009 and 2010 were included in the study. Thyroid function tests were performed two Pembrolizumab order times in all cases before and after H. pylori eradication. Duodenal, antral and corporal biopsies, and jejunal aspirates and biopsies were taken during upper gastrointestinal system endoscopies performed in all patients. Cases without intestinal pathology were included in the study. Results:  Serum thyrotropin (TSH), free T3, and free T4 values before H. pylori eradication were 30.5 ± 28.8 IU/mL, 2.64 ± 0.56 pg/mL, and 0.92 ± 0.32 ng/mL, respectively, and after eradication were found to be

medchemexpress 4.2 ± 10.6 IU/mL, 3.02 ± 0.61 pg/mL, and 1.3 ± 0.34 ng/mL, respectively (p values <.001, .002, and <.001, respectively). After H. pylori eradication treatment, TSH decreased in all of the cases, factitious thyrotoxicosis developed in % 21 of these cases. Conclusion:  In hypothyroid cases, H. pylori gastritis may be responsible for an inadequate response to the treatment. H. pylori eradication in the cases receiving high doses of thyroxine has a risk for thyrotoxicosis. "
“Dyspepsia is among the most common complaints evaluated by gastroenterologists, but there are few studies examining its current epidemiology, evaluation, and costs. We examined these issues in a large managed care system in the Southwestern United States. We conducted a retrospective case–control analysis of adults with incident dyspepsia or a Helicobacter pylori-related condition in years 2006 through 2010 using utilization data. Medical record abstraction of 400 cases was conducted to obtain additional clinical information. A total of 6989 cases met all inclusion and exclusion criteria. Women had a substantially higher risk of dyspepsia than men (14 per 1000 per year vs 10 per 1000; p < .001), and the incidence of dyspepsia increased with age such that persons in their seventh decade had almost twice the risk of those aged 18–29.

Conclusions:  AlbuMAX II® (Gibco BRL) can SP600125 supplier be used as

a serum/blood replacement for the cultivation of H. pylori in solid and liquid media. This medium could be useful for an improved understanding of H. pylori metabolism or for antigen production. Furthermore, AlbuMAX II® (Gibco BRL) may be suitable for use in remote locations, particularly in areas where frozen storage of serum may be a problem. “
“Background: Helicobacter pylori infection is a most frequent cause of chronic gastritis. H. pylori may decrease absorption of oral thyroxine by decreasing gastric acid secretion in the stomach. In this study, we aimed to investigate the change in thyroid function tests of the cases after H. pylori eradication who were not responding

to high doses of thyroxine treatment before H. pylori eradication. Methods:  Hypothyroid cases who were not responding to high doses of thyroxine among the ones presented to Endocrinology and Gastroenterohepatology Clinics of Sisli Etfal Training and Research Hospital between 2009 and 2010 were included in the study. Thyroid function tests were performed two Seliciclib order times in all cases before and after H. pylori eradication. Duodenal, antral and corporal biopsies, and jejunal aspirates and biopsies were taken during upper gastrointestinal system endoscopies performed in all patients. Cases without intestinal pathology were included in the study. Results:  Serum thyrotropin (TSH), free T3, and free T4 values before H. pylori eradication were 30.5 ± 28.8 IU/mL, 2.64 ± 0.56 pg/mL, and 0.92 ± 0.32 ng/mL, respectively, and after eradication were found to be

MCE 4.2 ± 10.6 IU/mL, 3.02 ± 0.61 pg/mL, and 1.3 ± 0.34 ng/mL, respectively (p values <.001, .002, and <.001, respectively). After H. pylori eradication treatment, TSH decreased in all of the cases, factitious thyrotoxicosis developed in % 21 of these cases. Conclusion:  In hypothyroid cases, H. pylori gastritis may be responsible for an inadequate response to the treatment. H. pylori eradication in the cases receiving high doses of thyroxine has a risk for thyrotoxicosis. "
“Dyspepsia is among the most common complaints evaluated by gastroenterologists, but there are few studies examining its current epidemiology, evaluation, and costs. We examined these issues in a large managed care system in the Southwestern United States. We conducted a retrospective case–control analysis of adults with incident dyspepsia or a Helicobacter pylori-related condition in years 2006 through 2010 using utilization data. Medical record abstraction of 400 cases was conducted to obtain additional clinical information. A total of 6989 cases met all inclusion and exclusion criteria. Women had a substantially higher risk of dyspepsia than men (14 per 1000 per year vs 10 per 1000; p < .001), and the incidence of dyspepsia increased with age such that persons in their seventh decade had almost twice the risk of those aged 18–29.

Conclusion: Strong association between physiological levels of serum BA and body mass index was observed in healthy subjects. BA determination within the physiological concentration range (hsBA) seems to reflect the overweight status. Clinical studies on patients with diabetes and metabolic syndrome are needed to assess the role of hsBA as a possible marker or predictor of these conditions. Supported by a grant NT13151-4 given by the Czech Ministry of Health. Key Word(s): 1. bile acids; 2. overweight; EX 527 research buy 3. obesity; 4. body mass

index Presenting Author: AHMAD NAJIB AZMI Additional Authors: KHEAN LEE GOH Corresponding Author: AHMAD NAJIB AZMI Affiliations: University of Malaya Objective: We report a case of advance, inoperable Barcelona Clinic Liver Cancer (BCLC) C hepatocellular carcinoma with CP score A that survives following Sorafenib therapy. Methods: A 63-year-old woman presented with complaint of vague abdominal pain, nausea, fatigue and general malaise for 1-month duration. She was not known to have viral hepatitis nor any liver disease prior to this. Clinically she appeared very lethargic. She was not pale nor jaundice. Abdominal examination revealed enlarged liver, 6 cm below

the costal margin and no ascites. Results: Blood investigations showed hemoglobin 16 g/dl, platelet 200 x 10 9 IU/ml, total bilirubin 18 umol/L, albumin 40 g/L, alanine aminotransferase 71 IU/L, international normalization ratio (INR) Gefitinib mw 1.1, alpha-fetoprotein (AFP) 101,506 IU/L and anti-HCV antibody was positive. CT liver 5-phase revealed a right lobe liver lesion (segment V & VIII) measured 7.5 x 8.0 cm consistent with HCC, no portal vein thrombosis. Surgery and radiofrequency ablation was not possible. Trans-arterial chemo-embolization was offered but patient did not keen to proceed. Sorafenib was

initiated at 400 mg twice daily. She developed several side effects; low-grade fever but later subsided, minimal rash on and off and diarrhea, 上海皓元 which were controlled with medication. AFP level at week 10, 12, 16 and 32 dropped tremendously to 652, 206, 19 and 5 respectively. CT liver 5-phase at week 24 showed complete tumor necrosis with evidence of complete response. Subsequent follow-up CT scan up to 4 years since Sorafenib was initiated showed stable disease with no evidence of recurrence and AFP remain below 3 IU/L. She is currently asymptomatic with good performance status. She received a total 30 weeks of Sorafenib treatment. Conclusion: Sorafenib is a multi-kinase inhibitor, which is effective in advance HCC.

The results with cholesterol homeostasis genes correlated with changes in nuclear localization of key regulators of cholesterol and bile acid homeostasis (e.g., sterol regulatory element binding protein-2 and liver receptor homolog-1); however, the pattern of these changes was less clear. For example, although expression of CYP7A1 in foz/foz mice fed HFD was less than half that of WT mice fed chow, nuclear localization of liver receptor homolog-1 was not different between these groups.

The authors then showed that insulin in vitro at similar levels found in foz/foz mice (up to 20 ng/mL)13 changed the expression of some of the cholesterol synthesis genes in a pattern similar to what was observed in vivo (e.g., sterol regulatory element binding protein-1, low-density lipoprotein receptor, and bile acid GSK1120212 cell line export protein). These in vitro results, although supportive of the concept that the authors promote, have some limitations. First, the authors did www.selleckchem.com/products/AZD2281(Olaparib).html not study the effect of these insulin concentrations directly on cholesterol flux in these cells. Second, these results ignore the fact that plasma insulin levels are equally elevated in foz/foz mice fed chow,13 which would imply that they would expect similar expression changes with

foz/foz mice on chow diet, which was not observed in their animal models (see Figs. 1-3 in van Rooyen DM et al.10). The last series of experiments are to test the effect of titrating cholesterol into the standard HFD on liver damage in the foz/foz mice. The results demonstrate that foz/foz mice accumulate CE and FC and develop inflammatory liver damage even on HFD without cholesterol and that these variables increase as the percentage of dietary cholesterol rises. Interestingly, HFD-fed WT mice do not develop significant liver

injury until dietary cholesterol 上海皓元医药股份有限公司 levels are high enough to accumulate in the liver. However, it should be noted that there are key differences between WT and foz/foz mice that cannot be explained simply by differential abilities to accumulate cholesterol. For example, at even the highest concentration of cholesterol (2%), the authors observed few fibrotic changes in WT mice, which is in contrast to foz/foz mice that were fibrotic even in the absence of added dietary cholesterol (see Fig. 6 in van Rooyen DM et al.10). Issues that remain after this study include whether the results observed here are specific to Alström syndrome, or are more generally applicable to fatty liver disease. First, it is unclear if the magnitude of increase in cholesterol observed in this study is relevant to human fatty liver disease. For example, hepatic CE levels do not differ between control, NAFLD and NASH in humans, but were >50-fold higher in foz/foz mice.11 Furthermore, hepatic FC levels are only 20% elevated in NASH versus NAFL, versus a much stronger increase in foz/foz mice.

TGF-β and PDGF were purchased from PeproTech Inc. (Rocky Hill, NJ). SB203580 and BAY 11-7082 were purchased from from GSI-IX clinical trial Calbiochem (San Diego, CA), U0126 was from Promega (Madison, WI), and LY-294002 was from Sigma-Aldrich (St. Louis, MO). Surgically resected liver tumor specimens from 16 patients with cirrhosis (hepatitis C virus [HCV], n = 7; alcoholic, n = 9) were examined. Informed

consent to all clinical investigations, in accord with the principles outlined in the Declaration of Helsinki, was provided. The institutional review board of the Hospital Clínic de Barcelona (Barcelona, Spain) approved the protocol. Animals were maintained in the CIC bioGUNE (Derio, Spain) animal facility with appropriate approvals from Selleck GSK3235025 the institutional

review committee on animal use. HSCs were isolated from livers of male Sprague-Dawley rats, bile duct ligated (BDL) mice, and sham-operated mice, as previously described.11 BDL was performed in 12-week-old mice by tying the common bile duct using a nonabsorbable filament. Mice (n = 8) were injected in the tail vein with 200 μL of a 0.75-μg/μL

solution of HuR-specific short hairpin RNA (shRNA) (sense 5′-gatgcagagagagcaatca-3′) or control shRNA (pSM2c; Open Biosystems, Lafayette, CO). Rats (n = 5) were treated with CCl4 diluted (1:1) in corn oil (0.5 μL of CCl4/g body weight) by intraperitoneal injection twice-weekly for 6 weeks. Control animals received vehicle alone (n = 5). Cells MCE公司 were treated with short-hairpin lentiviral particles against HuR [CCGGCCCAC AAATGTTAGACCAATTCTCGAGAATTGGTCTAA CATTTGTGGGTTTTTG] or against LKB1 [CCGG CATCTACACTCAGGACTTCACCTCGAGGTGAA GTCCTGAGTGT-AGATGTTTTT] in the presence of hexadimethrine bromide (8 μg/mL). For control cells, HSCs were infected with pLKO.1 lentiviral vector (Sigma-Aldrich). After 24-hour transduction, cells were selected using puromycin (1.25 μg/mL). Migration using the “scratch assay” was performed in liver kinase B1 (LKB1)- and HuR-silenced cells seeded onto poly-D-lysine–coated dishes, as previously described.

0–2.5 mg/kg for Caucasian. It has been reported that the lower dose (1.0–2.0 mg/kg) in some Asian countries was as effective as the standard dose. In the present study buy STA-9090 we analyzed the efficacy of <1.0 mg/kg AZA in maintaining remission for Chinese patients. Methods: The clinical data of all CD were reviewed from 1993 to December 2012. The patients

who initiated AZA treatment and were followed for ≥2 years with complete medical data were included. We divided the patients into two groups according to their initial dose: <1.0 mg/kg group and 1.0–2.0 mg/kg group. Results: Among 77 patients, 39 (50.6%) maintained remission with <1.0 mg/kg and 38 (49.4%) with 1.0–2.0 mg/kg of AZA. The mean dose of <1.0 mg/kg group continued <1.0 mg/kg and significant lower than 1.0–2.0 mg/kg group at 6, 12 and 24 months, even if the

doses were adjusted according to the efficacy and tolerance. The remission rate of <1.0 mg/kg group was significant higher than 1.0–2.0 mg/kg group (P = 0.025). Male, INCB018424 manufacturer older patients, heavier body weight and L1 location were associated with <1.0 mg/kg AZA. Adverse events observed in 31 of 77 patients (40.3%), there was no significant difference in occurrence of adverse events or leucopenia between two groups. Conclusion: The low dose AZA (<1.0 mg/kg) in maintaining remission was effective as 1.0–2.0 mg/kg among Chinese patients with CD. Key Word(s): 1. <1.0 mg/kg AZA; 2. maintain remission; 3. Crohn's disease; 4. Chinese patients; Presenting Author: YOULIAN ZHOU Additional MCE公司 Authors: YAN HE, TING ZHANG, ZHONGQIU WANG, SHAOHENG ZHANG, BO JIANG, YE CHEN Corresponding Author: YE CHEN Affiliations: Nanfang hospital; Department of Environmental Health, School of Public Health and Tropical Medicine Objective: The Infliximab have dramatically improved the treatment in Crohn’s disease

(CD). However, loss of response to Infliximab is an emerging clinical problem and the prospective studies of intestinal flora on anti-TNFα treatment are relatively unexplored. The aim of this study was to investigate effects of infliximab treatment on gut microbiome in patients with CD. Methods: 18 patients with CD (13 with sustained response, 5 with replase) treated with Infliximab (5 mg/kg at weeks 0, 2, and 6 and then every eight weeks) and 8 healthy controls was recruited. The fecal microbial community was analyzed by sequencing 16S rRNA V4 tags on Illumina Miseq platform followed by real-time quantitative polymerase chain reaction. Results: Dramatic shifts were observed both before and during infliximab treatment in both bacterial diversity and richness, while the microbial communities of health control subjects were relatively stable over time. Campared with sustained response group, the proportions of both phylum Proteobacteria and Bacteroidetes were increased in the replase group (P < 0.05). Positive correlations were observed between Veillonellaceae and disease duration (R = 0.4099, P = 0.014) or CRP (R = 0.4049, P = 0.

01). The risk for the

JAK2V617F-positive BCS with CC genotype was elevated compared with subjects presented TT genotype (OR = 13.4, 95%CI = 2.01–89.5) and non-CC genotype (OR = 15.0, 95%CI = 2.45–91.7). Our study showed that the presence of 46/1 haplotype increased the risk of JAK2V617F-positive BCS in China. In addition, low prevalence of JAK2V617F mutation in BCS patients suggested that myeloproliferative neoplasms (MPNs) should not be an etiological factor of BCS in China. Budd-Chiari syndrome (BCS) is defined as hepatic venous outflow obstruction at any level from the small selleck hepatic veins to the junction of the inferior vena cava (IVC) and the right atrium, regardless of the cause of obstruction.[1-3] BCS is divided into primary when related to a primarily venous disease and secondary when resulting from compression or invasion by a lesion originating outside the veins.[2] BCS is a rare disorder with an incidence of around 1 to 2 per million inhabitants in the Western world,[4] while a relatively higher prevalence in Asia countries such as China, Japan, and India.[5] In China, Henan, Shandong, Jiangsu, and Anhui provinces in Yellow River valley are considered as areas with high prevalence.[6, 7] The etiology of BCS has been attributed to a variety of genetic and environmental factors while myeloproliferative neoplasms (MPNs) is considered to be the leading cause of MK-8669 order BCS.

A somatic mutation identified in 40–59% of patients with BCS,[8-10] and 80% of MPNs is JAK2V617F mutation providing a robust diagnostic tool.[11] The prevalence of JAK2V617F mutation in Chinese BCS and the exact role in the pathogenic mechanism is unclear. Further somatic mutations have been reported in JAK2V617F-negative MPNs and BCS patients, including a cluster

of different mutations in exon 12 of JAK2, MPLW515L/K mutation, Factor V Leiden (FVL) mutation, MCE公司 and prothrombin G20210A mutation.[12-15] Recently, a series of studies showed that the presence of JAK2V617F is associated with an inherited JAK2 46/1 haplotype in MPNs and BCS.[16-19] Simultaneously, other studies suggested this haplotype also frequently occurs in JAK2V617F-negative BCS patients.[20, 21] These findings all implied that JAK2 46/1 haplotype might represent as a susceptible locus for the development of BCS. To investigate whether JAK2 46/1 haplotype is associated with BCS patients in China, we conducted a case-control study in Chinese individuals. We performed the study in the hospital affiliated to Xuzhou Medical Collage, China. Two-hundred and ninety-five Chinese BCS patients aged 10–79 years were involved in this study. BCS was diagnosed by Doppler ultrasound, computed tomography(CT), magnetic resonance imaging (MRI) and angiography according to the previously published criteria.[1] Outflow obstruction caused by hepatic veno-occlusive disease and cardiac disorders were excluded.

“
“Chronic infection with hepatitis B virus (HBV) is a major global health problem and an important cause of morbidity and mortality from sequelae of liver cirrhosis and hepatocellular carcinoma. In the past decades, better understanding of the natural history and immunopathogenesis of chronic HBV infection and of

the development of many powerful antiviral agents has allowed us to improve therapeutic efficacy. Among BVD-523 molecular weight these agents, nucleos(t)ide analogs are important and potent viral suppressors. However, when administered alone, they are not able to permanently eradicate HBV, and long-term maintenance therapy is required for therapeutic efficacy. Additionally, prolonged treatment is frequently associated with the emergence of drug-resistant HBV mutants.

Before an ‘ideal’ drug(s), or drug combination, with optimal antiviral efficacy and negligible rates of drug resistance becomes available, the on-treatment monitoring approach using serum HBV DNA level as a predictor for therapeutic efficacy and drug resistance is useful. However, most countries in the Asia–Pacific AZD2281 chemical structure region have low income economies, insufficient medical care systems, and low awareness of the disease among the general population and government officers. The easy approach of the road-map concept using an affordable drug to treat chronic HBV infection is more important in this region. There is already evidence that the long-term outcomes

of chronic HBV infection can be improved under well-managed antiviral therapy. Profound and long-lasting suppression of HBV replication, either maintained on-therapy or sustained after stopping therapy, has been identified as the key determinant for achieving the goals of therapy, for reducing liver damage, and for preventing development of cirrhosis and/ or hepatocellular carcinoma. Chronic infection with hepatitis B virus (HBV) is a major global health problem and an important cause of morbidity and mortality from sequelae such as liver cirrhosis and hepatocellular carcinoma (HCC). Approximately 2 billion people have been infected worldwide, 350 million of them became chronic infection, and about 1 million die annually.1 Of note, 75% of chronic HBV infected people reside in MCE公司 the Asia–Pacific region. In the past decades, research exploring the virus, the host and other factors contributing to the pathogenesis and outcomes of chronic hepatitis B has provided us with a better understanding of the natural history and immunopathogenesis of chronic HBV infection.2–6 In addition, treatment of patients with chronic hepatitis B has been evolving rapidly with an increasing range of treatment options and the availability of multiple new antiviral agents.7 The introduction of nucleos(t)ide analogs (NA) in the 1990s heralded a new era in the treatment of chronic HBV infection. NA inhibit the viral polymerase activity of HBV.

In vitro, S100-MPs are released from human T cells after activation (and apoptosis) and fuse with the cell membranes of HSCs and transfer membrane molecules (CD147, Emmprin), which triggers up-regulation of fibrolytic MMP-1, MMP-3, MMP-9, and MMP-13. Of note,

the circulating CD4+ and CD8+ S100-MPs found in patients’ plasma mainly derive from activated T cells, and their equivalent generated ex vivo by PHA stimulation of donor CD4+ and CD8+ T cells most strongly up-regulated putatively fibrolytic MMPs in HSCs (Table 1). This finding will likely have relevance in vivo, because activated HSCs are the principal driving force of liver selleck kinase inhibitor fibrogenesis. MPs were described as a product of various kinds of cell types, including T cells, as a product of activation or early apoptosis. However, characterization of the biological effects of these MPs has been limited. A prior study implicated MPs from the Jurkat T cell line in fibrolytic activation of synovial fibroblasts.8 Questions relevant to liver disease or diseases of other epithelial-mesenchymal organs have not been addressed. We demonstrated that increased T cell activation (and apoptosis) in active hepatitis C19 is paralleled by

excess release of T cell–derived www.selleckchem.com/products/AZD6244.html MPs, which can be detected in the circulation. Using T cell subpopulations and HSCs, both of which are key players in liver inflammation and fibrogenesis, we demonstrated the functional relevance of these MPs in vitro. Therefore, T cell MPs ameliorated or even blunted the fibrogenic response that is usually prevalent in chronic hepatitis,1 including the neutralization of fibrogenic activation of HSCs by TGFβ1, the strongest profibrogenic cytokine in hepatic fibrosis and other fibrotic diseases.2 Of note, not all T cell–derived MPs were equally potent inducers of fibrolytic MMP expression 上海皓元 in HSCs. Therefore, MPs derived from apoptotic and activated CD8+ T cells were the strongest inducers compared with MPs from activated CD4+

T cells or from the CD4-expressing Jurkat T cell line (Table 1). In this regard, it is noteworthy that CD8+ cells predominate in livers with hepatitis C, and the presence of CD8+ rather than CD4+ T cells has been correlated with the progression of liver fibrosis.20-22 These contrast with circulating MPs in inflammatory intestinal diseases where CD4+ T cell–derived MPs predominate (unpublished data). Therefore, MPs derived from activated (and apoptotic) CD8+ and CD4+ T cells may represent a negative feedback loop that counteracts the yet ill-defined profibrogenic activity of T cells once they become highly stimulated (as reproduced in vitro with PHA) with or without subsequent deletion by apoptosis. Human T cell–derived MPs could also potently induce MMP expression in primary HSCs from rats, suggesting a conserved mechanism, which is working beyond species boundaries.