TGF-β and PDGF were purchased from PeproTech Inc (Rocky Hill, NJ

TGF-β and PDGF were purchased from PeproTech Inc. (Rocky Hill, NJ). SB203580 and BAY 11-7082 were purchased from from GSI-IX clinical trial Calbiochem (San Diego, CA), U0126 was from Promega (Madison, WI), and LY-294002 was from Sigma-Aldrich (St. Louis, MO). Surgically resected liver tumor specimens from 16 patients with cirrhosis (hepatitis C virus [HCV], n = 7; alcoholic, n = 9) were examined. Informed

consent to all clinical investigations, in accord with the principles outlined in the Declaration of Helsinki, was provided. The institutional review board of the Hospital Clínic de Barcelona (Barcelona, Spain) approved the protocol. Animals were maintained in the CIC bioGUNE (Derio, Spain) animal facility with appropriate approvals from Selleck GSK3235025 the institutional

review committee on animal use. HSCs were isolated from livers of male Sprague-Dawley rats, bile duct ligated (BDL) mice, and sham-operated mice, as previously described.11 BDL was performed in 12-week-old mice by tying the common bile duct using a nonabsorbable filament. Mice (n = 8) were injected in the tail vein with 200 μL of a 0.75-μg/μL

solution of HuR-specific short hairpin RNA (shRNA) (sense 5′-gatgcagagagagcaatca-3′) or control shRNA (pSM2c; Open Biosystems, Lafayette, CO). Rats (n = 5) were treated with CCl4 diluted (1:1) in corn oil (0.5 μL of CCl4/g body weight) by intraperitoneal injection twice-weekly for 6 weeks. Control animals received vehicle alone (n = 5). Cells MCE公司 were treated with short-hairpin lentiviral particles against HuR [CCGGCCCAC AAATGTTAGACCAATTCTCGAGAATTGGTCTAA CATTTGTGGGTTTTTG] or against LKB1 [CCGG CATCTACACTCAGGACTTCACCTCGAGGTGAA GTCCTGAGTGT-AGATGTTTTT] in the presence of hexadimethrine bromide (8 μg/mL). For control cells, HSCs were infected with pLKO.1 lentiviral vector (Sigma-Aldrich). After 24-hour transduction, cells were selected using puromycin (1.25 μg/mL). Migration using the “scratch assay” was performed in liver kinase B1 (LKB1)- and HuR-silenced cells seeded onto poly-D-lysine–coated dishes, as previously described.

Leave a Reply

Your email address will not be published. Required fields are marked *

*

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>