LLO expression was verified by Western blotting as described below. To obtain a plasmid for LLO expression in L. innocua, the DNA fragment carrying the prfA* gene encoding the transcriptional regulator PrfA* was obtained in PCR using the lysate of the L. monocytogenes NCTC5105 cells (prfA* phenotype, [19]) and prf1 and prf2 primers (prf1: 5′ – CCCAGTTCTTTCAGGTCCGGC; prf2: 5′ – ACT CACGCAAATTCGGCATGC). PrfA regulator is necessary for the hly gene expression, the substitution Gly145Ser in the PrfA* protein results in constitutive PrfA protein activity and Gemcitabine constitutive the hly gene expression [19]. The ends of the

obtained PCR product were blunted with T4-polymerase. After that it was inserted into the SmaI restriction site on the pHly plasmid. The plasmid designated pHly/PrfA* was introduced into the L. innocua strain NCTC11288 by electroporation [42]. SDS-PAGE and Western immunoblotting L. monocytogenes and L. innocua strains were grown overnight on LB, supplemented with erythromycin 10 μg/ml when necessary, at 28°C. Secreted proteins present in 1.5 ml of cell free culture supernatant were precipitated on ice for 1 h with 10% trichloroacetic acid followed by centrifugation at 10 000 rpm for 30 min. The protein pellet was washed with 70% ethanol,

resuspended in 1× Laemmli INCB28060 in vivo buffer and boiled for 5 min. Proteins were separated onto 10 % SDS-PAGE gels and visualized by staining with Coomassie Brilliant Blue R-250. For Western analysis proteins were DNA Damage inhibitor transferred electrophoretically from SDS-PAGE gels onto the nitrocellulose P505-15 purchase membrane (Amersham) using a Mini-Protein Cuvette (Bio Rad). LLO was detected with polyclonal rabbit primary antibodies raised against the purified L. monocytogenes LLO [43], secondary horseradish peroxidase-conjgated goat anti-rabbit antibodies (Bio-Rad) and visualized with the TMB stabilized substrate

(Promega). Sample preparation and PCR The quantitative PCR (qPCR) was performed using bacterial lysates obtained after bacterial cell treatment with lysozyme (2 mg/ml) at 37°C for 1 h and Proteinase K (100 μg/ml) at 56°C for 1 h followed by boiling for 10 min. Bacteria-containing T. pyriformis cysts were subjected to ultrasound treatment for 1 min (4 cycles of 15 seconds at a maximal amplitude) and then to the same treatment as described above. The act1 and act2 primers and the TaqMan probe were specific for the L. monocytogenes chromosomal actA gene (act1: 5′-AAAGATGCGGGGAAATGGG; act2: 5′-TGGTGTCTCTGGCAAAGCA; TaqMan: act 5′-FAM-ATG-CTT-CGG-ACT-TCC-CGC-CAC-CAC-CTA-BHQ1). qPCR was carried out in a 25 μl reaction volume containing 1 μl of bacterial lysate, 5 pM of each primers, 2.5 pM of the TaqMan probe and 1 U of Taq-polymerase (qPCR degree, Syntol, Russia) with the ANK-16 amplification and detection system (Syntol, Russia).